circad | circRNAs associated with diseases

hsa_circRNA_102958
Gene	n/a	Organism	Human
Genome Locus	n/a	Build	hg19
Disease	Gastric Cancer	ICD-10	Stomach, Malignant neoplasm of unspecified (C16.9)
DBLink	Link to database	PMID	30689557
Experimental Method
Sample Type	Tissues	Comparison	3 gastric cancer tissues and their matched non-gastric cancer (non-GC) tissues were collected
Method for Estimation	Quantitative PCR and Microarrays	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward GGATGCCCGCCAGAGTCCAGAT Reverse ACGGGCTCCTTGGTGGGGTTA	Statistics	Fold Change : Upregulated pvalue : p<0.05
Citation
Wei, J, Wei, W, Xu, H, Wang, Z, Gao, W, Wang, T, Zheng, Q, Shu, Y, De, W (2019). Circular RNA hsa_circRNA_102958 may serve as a diagnostic marker for gastric cancer. Cancer Biomark, :no page given.